View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1399_low_29 (Length: 381)
Name: NF1399_low_29
Description: NF1399
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1399_low_29 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 149 - 368
Target Start/End: Complemental strand, 12035965 - 12035747
Alignment:
| Q |
149 |
tacttaactttctattattcatcgatgcggcttaggattatcgatatcatggaagtacggtgaggagaaattttctaagtgacattgagagtgcaactcg |
248 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||| |
|
|
| T |
12035965 |
tacttaactttctattattcatcggtgcggtttaggattatcaatatcatggaagtacggtgaggagaaattttctaagtgatattgagagtgcaattcg |
12035866 |
T |
 |
| Q |
249 |
attatccggagataccgtgcaactttttgtgtcgcctaaagaaattttggtgtaagtcgagtaagccgaagagggtttaaagtacccaaatttgcaagag |
348 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12035865 |
attatccggagataccgcgcaactttttgtgtcgcctaaagaaattttggtgtaagtcgagtaagccgaagagggtttaaagtacccaaatttgcaagag |
12035766 |
T |
 |
| Q |
349 |
cacaaacccacgttcttttc |
368 |
Q |
| |
|
|||||| ||||||||||||| |
|
|
| T |
12035765 |
cacaaa-ccacgttcttttc |
12035747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University