View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1399_low_39 (Length: 329)
Name: NF1399_low_39
Description: NF1399
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1399_low_39 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 65 - 262
Target Start/End: Original strand, 34796542 - 34796739
Alignment:
| Q |
65 |
agcataggtagtgttggtgctgcttcttctgtgtgtttggagctatggcatgcttgtgctggtcctatgatctctttgccaaagaaaggaagtgttgttg |
164 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34796542 |
agcataggtagtgttggtgctggttcttctgtgtgtttggagctatggcatgcttgtgctggtcctatgatctctttgccaaagaaaggaagtgttgttg |
34796641 |
T |
|
| Q |
165 |
tttacttccctcaaggacacttggaacatcttcatgattttccgttatctttttcggataatattccttctcatgtgttctgtcgtgttgatgatgtc |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
34796642 |
tttacttccctcaaggacacttggaacatcttcatgattttccgttatctttttcggataatattccttctcatgtgttctgtcgtgttgttgatgtc |
34796739 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 108 - 192
Target Start/End: Original strand, 22234596 - 22234680
Alignment:
| Q |
108 |
tatggcatgcttgtgctggtcctatgatctctttgccaaagaaaggaagtgttgttgtttacttccctcaaggacacttggaaca |
192 |
Q |
| |
|
||||||||||||||||||||||| | | ||| | || |||||||||| |||||| || || || || ||||| ||||||||||| |
|
|
| T |
22234596 |
tatggcatgcttgtgctggtcctcttacctcacttcctaagaaaggaaatgttgtggtgtattttccacaaggtcacttggaaca |
22234680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 91 - 207
Target Start/End: Complemental strand, 4274533 - 4274417
Alignment:
| Q |
91 |
ttctgtgtgtttggagctatggcatgcttgtgctggtcctatgatctctttgccaaagaaaggaagtgttgttgtttacttccctcaaggacacttggaa |
190 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||| |||||||||| | || ||||||||||| ||| |
|
|
| T |
4274533 |
ttctgtttgtttggagctatggcatgcttgtgctggtcctttgatctctttaccaaagaaaggaagcattgttgtttatgttccacaaggacactttgaa |
4274434 |
T |
|
| Q |
191 |
catcttcatgattttcc |
207 |
Q |
| |
|
|| |||||||||||| |
|
|
| T |
4274433 |
caagctcatgattttcc |
4274417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University