View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1399_low_51 (Length: 282)
Name: NF1399_low_51
Description: NF1399
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1399_low_51 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 29 - 267
Target Start/End: Original strand, 4165038 - 4165280
Alignment:
| Q |
29 |
aaataccactctgcattcaagtgcactaga----taaaggtcagttctctgcaaatgctagactacttttaggtaaggtatgtgccaaagctgggctacg |
124 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4165038 |
aaataccactctgcattcatgtgcactagatagataaaggtcagttctctgcaaatgctagactactttcaggtaaggtatgtgccaaagctgggctacg |
4165137 |
T |
|
| Q |
125 |
acagcaaatgaggtgcaatttgagaatctttgggatttgggtggtgataaaaaagcaaaacaatgatgaaatagttggtgtagactttaaaaatccaggg |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4165138 |
acagcaaatgaggtgcaatttgagaatctttgggatttgggtggtgataaaaaagcaaaacaatgatgaaatagttggtgtagactttaaaaatccaggg |
4165237 |
T |
|
| Q |
225 |
tgtataagtgtcgtcacataagtgtagaagaaaattctataat |
267 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
4165238 |
tgtataagtgtcgtcacataagtgtagaggaaaattctataat |
4165280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University