View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1399_low_55 (Length: 274)

Name: NF1399_low_55
Description: NF1399
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1399_low_55
NF1399_low_55
[»] chr5 (1 HSPs)
chr5 (1-245)||(43055541-43055785)
[»] chr1 (1 HSPs)
chr1 (39-104)||(44805141-44805206)
[»] chr6 (2 HSPs)
chr6 (39-110)||(11788736-11788807)
chr6 (39-69)||(17543051-17543081)


Alignment Details
Target: chr5 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 43055541 - 43055785
Alignment:
1 ttgcaatcacatgtttttaagtacttannnnnnncttgcaggtactgtttagacggacctgtgatttttaccaaggaagttatatggttatgtgaggatt 100  Q
    ||||||||||||||||||||||||||        |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
43055541 ttgcaatcacatgtttttaagtacttctttttttcttgcaggtactgtttagacggacctgtgatttttaccgaggaagttatatggttatgtgaggatt 43055640  T
101 gtgacgaagaaacaggaccgtgtccaatgactgactctgaaactgatgattcaataacatcagaagatgattttaaggcacgacctattcttgatgcaaa 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43055641 gtgacgaagaaacaggaccgtgtccaatgactgactctgaaactgatgattcaataacatcagaagatgattttaaggcacgacctattcttgatgcaaa 43055740  T
201 ctggaggtatgaattttgttttgctttatttgaaaatcggcgaac 245  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
43055741 ctggaggtatgaattttgttttgctttatttgaaaatcggcgaac 43055785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 39 - 104
Target Start/End: Original strand, 44805141 - 44805206
Alignment:
39 caggtactgtttagacggacctgtgatttttaccaaggaagttatatggttatgtgaggattgtga 104  Q
    |||||||||||||||||||||||||||||||||| | ||||| |||||||| |||||||| |||||    
44805141 caggtactgtttagacggacctgtgatttttaccgatgaagtgatatggttttgtgaggactgtga 44805206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 32; Significance: 0.000000006; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 39 - 110
Target Start/End: Complemental strand, 11788807 - 11788736
Alignment:
39 caggtactgtttagacggacctgtgatttttaccaaggaagttatatggttatgtgaggattgtgacgaaga 110  Q
    |||||| ||||||||||| ||||||||||||||  | || ||||| ||||  |||||||||||||| |||||    
11788807 caggtattgtttagacgggcctgtgatttttacggatgaggttatttggtattgtgaggattgtgaagaaga 11788736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 39 - 69
Target Start/End: Complemental strand, 17543081 - 17543051
Alignment:
39 caggtactgtttagacggacctgtgattttt 69  Q
    |||||||||||||||||||||||||||||||    
17543081 caggtactgtttagacggacctgtgattttt 17543051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University