View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1399_low_56 (Length: 270)
Name: NF1399_low_56
Description: NF1399
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1399_low_56 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 66 - 245
Target Start/End: Complemental strand, 15115764 - 15115585
Alignment:
| Q |
66 |
ttttctcatgcaaatacatcaaacttgacaccttttttaccttatggagttaaaggtgtatttcaagcatctgcaattctatattttgcatatggagggt |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15115764 |
ttttctcatgcaaatacatcaaacttgacaccttttttaccttatggagttaaaggtgtatttcaagcatctgcaattctatattttgcatatggagggt |
15115665 |
T |
 |
| Q |
166 |
ttgacagtcttgcaaccatggctgaagaaactaaaaatccgccaaaggacataccaataggcttgattggttcaatgtct |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15115664 |
ttgacagtcttgcaaccatggctgaagaaactaaaaatccgccaaaggacataccaataggcttgattggttcaatgtct |
15115585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University