View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1399_low_59 (Length: 267)
Name: NF1399_low_59
Description: NF1399
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1399_low_59 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 16 - 267
Target Start/End: Original strand, 44841665 - 44841915
Alignment:
| Q |
16 |
atgggtggtgggatgaaaaagtgagactttgctactatttgaatacaactactcgggatgcatctgcgattgaagttttcaccataaccagctgccagca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44841665 |
atgggtggtgggatgaaaaagtgagactttgctactatttgaatacaactactcgggatgcatctgcgattgaagttttcaccataaccagctgccagca |
44841764 |
T |
 |
| Q |
116 |
ttaccgatcggatataattgtattttgagtagtgctatataatgtgaatttatcctcacgaaagcatgctagtgtacacacacattgaaattgnnnnnnn |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44841765 |
ttaccgatcggatataattgtattttgagtagtgctatataatgtgaatttatcctcacgaaagcatgctagtgtacacacacattgaaattg-tttttt |
44841863 |
T |
 |
| Q |
216 |
naaggcaatgctatgtactcacaaacccacgattaattatgggttatttttt |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44841864 |
taaggcaatgctatgtactcacaaacccacgattaattatgggttatttttt |
44841915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 16 - 48
Target Start/End: Complemental strand, 35796124 - 35796092
Alignment:
| Q |
16 |
atgggtggtgggatgaaaaagtgagactttgct |
48 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
35796124 |
atgggtggtgggatgaaaaagtgagactttgct |
35796092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University