View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1399_low_61 (Length: 263)
Name: NF1399_low_61
Description: NF1399
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1399_low_61 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 1 - 140
Target Start/End: Complemental strand, 16471747 - 16471608
Alignment:
| Q |
1 |
caagcaacaaatgcaaaataagcaacaagacttcacttcacatctatcttgctgaaaatatcaatcatttcatattctaataatttgagacaaacaaata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16471747 |
caagcaacaaatgcaaaataagcaacaagacttcacttcacatctatcttgctgaaaatatcaatcatttcatattctaataatttgagacaaacaaata |
16471648 |
T |
 |
| Q |
101 |
gaactaaaagggacaaaatcacttggcttggttttgctta |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16471647 |
gaactaaaagggacaaaatcacttggcttggttttgctta |
16471608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 111 - 203
Target Start/End: Complemental strand, 5263647 - 5263555
Alignment:
| Q |
111 |
ggacaaaatcacttggcttggttttgcttagaaacatgataatccctttggccttggaattaggtctaaggcaatatgatgcaaaacttgttg |
203 |
Q |
| |
|
||||||||||| ||| ||| ||||| |||||||||||||||| | |||||| ||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
5263647 |
ggacaaaatcagttgcgatggctttgcatagaaacatgataatctcattggccatggaatttggtctaaggcaatatgatgcaaaacttgttg |
5263555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University