View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1399_low_66 (Length: 251)
Name: NF1399_low_66
Description: NF1399
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1399_low_66 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 12 - 244
Target Start/End: Complemental strand, 45254384 - 45254152
Alignment:
| Q |
12 |
gaaaactcagtatttggcccaaagaccggctattgtgatcaaaatcccaccgtccactagcagggcccaaactgagtccagagctttgtatggacggact |
111 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45254384 |
gaaaactcagtatttggcccaaagactggctattgtgatcaaaatcccaccgtccactaacagggcccaaactgagtccagagctttgtatggacggact |
45254285 |
T |
 |
| Q |
112 |
ggcccaacacaggaattgttgacccctgggggatttcaacgagaggcctagatttgaattatttgttagccatgttaaaaatgattagagtagaacactg |
211 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45254284 |
ggcccaacacaggaattgttgacacctgggggatttcaacgagaggcctagatttgaattatttgttagccatgttaaaaatgattagagtagaacactg |
45254185 |
T |
 |
| Q |
212 |
acaatcatttgctttaccttgctacctttgttt |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
45254184 |
acaatcatttgctttaccttgctacctttgttt |
45254152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University