View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1399_low_73 (Length: 223)
Name: NF1399_low_73
Description: NF1399
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1399_low_73 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 57 - 145
Target Start/End: Complemental strand, 30519262 - 30519174
Alignment:
| Q |
57 |
agcaagaacaaattatgggataatcattccaaatggagatcaactttcttccaacctcatcatatgtgtcatcatacacctttgcttct |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30519262 |
agcaagaacaaattatgggataatcattccaaatggagatcaactttcttccaacctcatcatatgtgtcatcatacacctttgcttct |
30519174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 30519315 - 30519283
Alignment:
| Q |
1 |
aatatagaaaaggttattggatgaaataggatt |
33 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
30519315 |
aatatagaaaaggttattggatgaaataggatt |
30519283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 63 - 141
Target Start/End: Complemental strand, 38897153 - 38897072
Alignment:
| Q |
63 |
aacaaattatgggataatcattccaaatggagatcaactttcttcc----aacctcatcatatgtgtcatcatacacctttgc |
141 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
38897153 |
aacaaattatgagataatcattccaaatggatg-caactttcttgctatcaacctcatcatatgtgtcatcatacacctttgc |
38897072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University