View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1399_low_75 (Length: 220)

Name: NF1399_low_75
Description: NF1399
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1399_low_75
NF1399_low_75
[»] chr7 (1 HSPs)
chr7 (80-113)||(40992108-40992141)


Alignment Details
Target: chr7 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 80 - 113
Target Start/End: Complemental strand, 40992141 - 40992108
Alignment:
80 caggtgctacgtgatcgcttgaaaaatattcttc 113  Q
    ||||||||||||||||||||||||||||||||||    
40992141 caggtgctacgtgatcgcttgaaaaatattcttc 40992108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University