View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14002_high_14 (Length: 218)
Name: NF14002_high_14
Description: NF14002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14002_high_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 35449840 - 35450040
Alignment:
| Q |
1 |
agaaaaatgtgaaagacttctcttggaaaagctagttttccatcaacaacaaaatgctccactttccggagtttcaagcattgaagatgaacaagttaca |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35449840 |
agaaaaatgtcaaagacttctcttggaaaagctagttttccatcaacaacaaaatgatccactttccggagtttcaagcattgaagatgaacaagttaca |
35449939 |
T |
 |
| Q |
101 |
agaaaaggaattgactcaaacaatggtttttctttgtcttcatcagattgtgaagaaagcattgtttcttcaccaattattgatcaatcaatgattgaag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35449940 |
agaaaaggaattgactcaaacaatggtttttctttgtcttcttcagattgtgaagaaagcattgtttcttcaccaattattgatcaatcaatgattgaag |
35450039 |
T |
 |
| Q |
201 |
t |
201 |
Q |
| |
|
| |
|
|
| T |
35450040 |
t |
35450040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University