View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14003_high_26 (Length: 235)
Name: NF14003_high_26
Description: NF14003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14003_high_26 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 148 - 235
Target Start/End: Complemental strand, 47626162 - 47626075
Alignment:
| Q |
148 |
atactattgttgcagactgtttgtaatttaggggtgtggtgcttttctgtacaacagttaggtgtatcgtttcttgttgctcactttc |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47626162 |
atactattgttgcagactgtttgtaatttaggggtgtggtgcttttctgtacaacagttaggtgtatcgtttcttgttgctcactttc |
47626075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 47626292 - 47626232
Alignment:
| Q |
18 |
aatttggtgttggattcattagccaaactaattacaaccacaaaattgaaggttcagtagg |
78 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47626292 |
aatttggtgttggattcattagccaaactaattacaaccacaaaattgaaggttcagtagg |
47626232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University