View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14003_low_26 (Length: 235)

Name: NF14003_low_26
Description: NF14003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14003_low_26
NF14003_low_26
[»] chr4 (2 HSPs)
chr4 (148-235)||(47626075-47626162)
chr4 (18-78)||(47626232-47626292)


Alignment Details
Target: chr4 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 148 - 235
Target Start/End: Complemental strand, 47626162 - 47626075
Alignment:
148 atactattgttgcagactgtttgtaatttaggggtgtggtgcttttctgtacaacagttaggtgtatcgtttcttgttgctcactttc 235  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47626162 atactattgttgcagactgtttgtaatttaggggtgtggtgcttttctgtacaacagttaggtgtatcgtttcttgttgctcactttc 47626075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 47626292 - 47626232
Alignment:
18 aatttggtgttggattcattagccaaactaattacaaccacaaaattgaaggttcagtagg 78  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47626292 aatttggtgttggattcattagccaaactaattacaaccacaaaattgaaggttcagtagg 47626232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University