View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14004_high_3 (Length: 251)
Name: NF14004_high_3
Description: NF14004
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14004_high_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 36167196 - 36167427
Alignment:
| Q |
1 |
tatgatatatgaaatatgaattgagatagaaacatagataaccctttatttacataaagtcaagcggttacaatattatccataatttactttgagtgat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
36167196 |
tatgatatatgaaatatgaattgagatagaaacatagataaccctttatttacataaagtcaagcggttacaatactatccataatttactttgagtgat |
36167295 |
T |
 |
| Q |
101 |
tataaattctaaaatttactattcttagaattcattgcaagttattggtatggccaacctccaaagttttacttaaattatttacatataatgtagcata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36167296 |
tataaattctaaaatttactattcttagaattcattgcaagttattggtatggccaacctccaaagttttacttaaattatttacatataatgtagcata |
36167395 |
T |
 |
| Q |
201 |
tactataaatgaaaagaagttggttactctgt |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
36167396 |
tactataaatgaaaagaagttggttactctgt |
36167427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University