View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14004_low_4 (Length: 245)
Name: NF14004_low_4
Description: NF14004
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14004_low_4 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 168; Significance: 4e-90; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 9 - 229
Target Start/End: Original strand, 24480693 - 24480905
Alignment:
| Q |
9 |
ttctccagatccacatacaatgacattattcatgagagtagctattttagcagcaaaaatttgttttcaaacatgatacttgcttatcacctacaaaaca |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
24480693 |
ttctccagatccacatacaatgacattattcatgagagttgctattttagcagcaaaaat--------aaacatgatacttgcttatcacctacaaaaca |
24480784 |
T |
|
| Q |
109 |
aatgtgattgttttgtccagaattgagggttgatgatcgtgcctttatccctcactgtccatgtacctatacccttgtttttcattatgtgcatcaacac |
208 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| | |
|
|
| T |
24480785 |
aatgtgattgttttgtcaagaattgagggttgatgatcgtgcctttatccctcactgtccatgtacctatgcccttgtttttcattatgtgcgtcaaccc |
24480884 |
T |
|
| Q |
209 |
aattagaatttcttataaacc |
229 |
Q |
| |
|
| ||||||||||||||||||| |
|
|
| T |
24480885 |
acttagaatttcttataaacc |
24480905 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 9 - 229
Target Start/End: Original strand, 24470624 - 24470846
Alignment:
| Q |
9 |
ttctccagatccacatacaatgacat---tattcatgagagtagctattttagcagcaaaaatttgttttcaaacatgatacttgcttatcacctacaaa |
105 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||||| ||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
24470624 |
ttctccagacccacatacaatgacatctttattcatgacagtagctattttagcagcaaaaatttgttatcaaacatggtacttgcttatcacctacaaa |
24470723 |
T |
|
| Q |
106 |
acaaatgtgattgttttgtccagaattgagggttgatgatcgtgcctttatccctcactgtccatgtacctatacccttgtttttcattatgtgcatcaa |
205 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||| ||| |||||||||| |
|
|
| T |
24470724 |
acaaatgtcattgttttgtcgagaattgagggttgatgatcgtgcctttatccctcactgtccatgtacctatgcccctgttttt-attctgtgcatcaa |
24470822 |
T |
|
| Q |
206 |
cacaattagaatttcttataaacc |
229 |
Q |
| |
|
|||| ||||||||||||||||||| |
|
|
| T |
24470823 |
cacacttagaatttcttataaacc |
24470846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University