View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14005_low_19 (Length: 281)
Name: NF14005_low_19
Description: NF14005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14005_low_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 57 - 192
Target Start/End: Complemental strand, 39040572 - 39040439
Alignment:
| Q |
57 |
ctccataacacttctccttgtctattgatgtcaatgttaacttgtaaatgagagaatatgtgtggactgtccagcttggggatcaacaagggacagagac |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39040572 |
ctccataacacttctccttgtctattgatgtcgatgttaacttgtaaatgaga--atatgtgtggactgtccagcttggggatcaacaagggacacagac |
39040475 |
T |
 |
| Q |
157 |
aagcagataaacctccccaatcgcatagtatgaatg |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
39040474 |
aagcagataaacctccccaatcgcatagtatgaatg |
39040439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University