View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14005_low_21 (Length: 270)
Name: NF14005_low_21
Description: NF14005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14005_low_21 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 11 - 252
Target Start/End: Complemental strand, 37406145 - 37405904
Alignment:
| Q |
11 |
cacagagaacggcacgcttgttatatcttcttggaaaagatgaggggaatgcaattgaaggagatggtgatgatgaccaaccaagaaaatttccattttt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37406145 |
cacagagaacggcacgcttgttatatcttcttggaaaagatgagggaaatgcaattgaaggagatggtgatgatgaccaaccaagaaaatttccattttt |
37406046 |
T |
|
| Q |
111 |
atttgaattgtcaagtttgaacaatttgcttccgannnnnnncacggaaccaaccaggcagttttcccttgatttcccatgttccaaagatgaattacaa |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
37406045 |
atttgaattgtcaagtttgaacaatttgcttccgatttttttcaccgaaccaaccaggcagttttcccttgatttcccatgttccaaagctgaattacaa |
37405946 |
T |
|
| Q |
211 |
atattacatagaaagcaacaacaacctctgcagggtgctttt |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37405945 |
atattacatagaaagcaacaacaacctctgcagggtgctttt |
37405904 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University