View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14005_low_23 (Length: 246)
Name: NF14005_low_23
Description: NF14005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14005_low_23 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 196; Significance: 1e-107; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 18 - 246
Target Start/End: Complemental strand, 24401803 - 24401575
Alignment:
| Q |
18 |
gaagattgaccagattttgtcagcaacactagcagccggtactcctgtcaaacttcccataacttttccattttctgcaagtgcaaccaaagtcctatga |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24401803 |
gaagattgaccagattttgtcagcaacactagcagtcggtactcctgtcaaacttcccataacttttccattttctgcaagtgcaaccaaagtcctatga |
24401704 |
T |
 |
| Q |
118 |
agtatgaatatttatagttgcataatatcgattttgggatactaatannnnnnnccgtcgtgatgttgctttaactatagaaccaattaagcaatatctt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24401703 |
agtatgaatatttatagttgcataatatcgattttgggatactaatatttttttacgtcatgatgttgctttaactatagaaccaattaagcaatatctt |
24401604 |
T |
 |
| Q |
218 |
tatttaaatgtatatctttagatctggtt |
246 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
24401603 |
tatttaaatgtatatctttagatctggtt |
24401575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 18 - 126
Target Start/End: Complemental strand, 24379009 - 24378901
Alignment:
| Q |
18 |
gaagattgaccagattttgtcagcaacactagcagccggtactcctgtcaaacttcccataacttttccattttctgcaagtgcaaccaaagtcctatga |
117 |
Q |
| |
|
||||||| |||||||||||||||||||| |||||| | |||||||||||||||||||||||| | ||||||||||||||||||||||| || |||||||| |
|
|
| T |
24379009 |
gaagattaaccagattttgtcagcaacattagcagtctgtactcctgtcaaacttcccataattcttccattttctgcaagtgcaacccaattcctatga |
24378910 |
T |
 |
| Q |
118 |
agtatgaat |
126 |
Q |
| |
|
||| ||||| |
|
|
| T |
24378909 |
agtgtgaat |
24378901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University