View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14005_low_24 (Length: 242)
Name: NF14005_low_24
Description: NF14005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14005_low_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 24 - 230
Target Start/End: Original strand, 31054423 - 31054629
Alignment:
| Q |
24 |
gtattttgatttgatcatcttgagatttagagcatatattgatataatctattttcaagccttaacacacatttacacaggcacatcatgtagatccact |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
31054423 |
gtattttgatttgatcatcttgagatttagagcatatattgatataatctattttcaagccttaacacacatttacacaggcacatcatgtagatgcact |
31054522 |
T |
 |
| Q |
124 |
cttacatttatcatacttcaatattttccaacaaaagtatgctatttacactttcaaagctatgcttacaaacaaattgattttaacacttctcttttat |
223 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
31054523 |
catacatttatcatacttcaatattttccaacaaaagtatgctatttacactttcaaagctatgcttacagacaaattgattttaacacttctcttttat |
31054622 |
T |
 |
| Q |
224 |
tcatctc |
230 |
Q |
| |
|
|||||| |
|
|
| T |
31054623 |
ccatctc |
31054629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University