View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14006_high_11 (Length: 311)
Name: NF14006_high_11
Description: NF14006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14006_high_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 15 - 300
Target Start/End: Complemental strand, 3843764 - 3843480
Alignment:
| Q |
15 |
caatatcaataaaa-cccaccctccaaatcttacccaccccgttaattggtggtccttgaagcaaattagggtgaaagaggcaaatgcctcaggtgattc |
113 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3843764 |
caatatcaataaaaacccaccctccaaatcttacccaccccgttaattggtggtccttgaagcaaattagggtgaaagaggcaaatgcctcaggtgattc |
3843665 |
T |
 |
| Q |
114 |
atatactttgcaaccaaggtcacagttgggtgttcctagtggaccccttggtccatatctctcttgctttgtgtgtcacacaaaattgtcattgttcata |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3843664 |
atatactttgcaaccaaggtcacagttgggtgttcctagtggaccccttggtccatatctctcttgctttgtgtgtcacacaaaattgtcattgttcata |
3843565 |
T |
 |
| Q |
214 |
tgttaccactagtggtagctatagtttttaattaattaacctcgtcataatcatgataaaatcacacagccaaccttagcagttcat |
300 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3843564 |
tgttaccactagtggtagc--tagtttttaattaattaacctcgtcataatcatgataaaatcacacagccaaccttagcagttcat |
3843480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University