View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14006_high_13 (Length: 297)
Name: NF14006_high_13
Description: NF14006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14006_high_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 263; Significance: 1e-147; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 16 - 278
Target Start/End: Original strand, 52765291 - 52765553
Alignment:
| Q |
16 |
atgaaggttacgtagcacatgcaatgcgccagtaattacaaatgtagggaaattttcggtagagtttctgattcttccatatgcactaaaacaagcaatc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52765291 |
atgaaggttacgtagcacatgcaatgcgccagtaattacaaatgtagggaaattttcggtagagtttctgattcttccatatgcactaaaacaagcaatc |
52765390 |
T |
 |
| Q |
116 |
tatgaattgtgtatcattagccctattgtatgctatgtaccttaacctatatcattgggggcagtacatacttatagaaacattatacatcacatatatt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52765391 |
tatgaattgtgtatcattagccctattgtatgctatgtaccttaacctatatcattgggggcagtacatacttatagaaacattatacatcacatatatt |
52765490 |
T |
 |
| Q |
216 |
tacgcacatacttttagaagcatttaacattatgaaccaaagaaaatcacttttccaactcat |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52765491 |
tacgcacatacttttagaagcatttaacattatgaaccaaagaaaatcacttttccaactcat |
52765553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University