View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14006_high_15 (Length: 267)
Name: NF14006_high_15
Description: NF14006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14006_high_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 1 - 255
Target Start/End: Original strand, 6083438 - 6083692
Alignment:
| Q |
1 |
ctctgatgtatgaggctcgagtgcttcaaaaggaacttgatattcgaaatgaagtccaattttcaagagtaatgctttcgcaaacagcgtcaaaactgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6083438 |
ctctgatgtatgaggctcgagtgcttcaaaaggaacttgatattcgaaatgaagtccaattttcaagagtaatgctttcgcaaacagcgtcaaaactgtt |
6083537 |
T |
 |
| Q |
101 |
gcaacttgaatctgagattgattccaaaaaccaagtagcatcggagcagcctagaagtcatgttgcattgcaagagttatctttggcatcaatgtcttac |
200 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6083538 |
gcaacttgagtctgagattgattccaaaaaccaagtagcatcggagcagcctagaagtcatgttgcattgcaagagttatctttggcatcaatgtcttac |
6083637 |
T |
 |
| Q |
201 |
attggcagtgatgacaatgttagctgtggggagtccttggcttctgcattgattt |
255 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
6083638 |
attggcagtgatgacaatgttagctgcggggagtccttggcttctgcattgattt |
6083692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 180 - 252
Target Start/End: Complemental strand, 39107438 - 39107366
Alignment:
| Q |
180 |
tctttggcatcaatgtcttacattggcagtgatgacaatgttagctgtggggagtccttggcttctgcattga |
252 |
Q |
| |
|
||||||||||||| |||| | ||||||||||||||||| |||||||||| || |||| |||||||||||||| |
|
|
| T |
39107438 |
tctttggcatcaacgtctgatattggcagtgatgacaaggttagctgtgctgactcctcggcttctgcattga |
39107366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University