View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14006_high_21 (Length: 239)
Name: NF14006_high_21
Description: NF14006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14006_high_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 18 - 232
Target Start/End: Original strand, 9536125 - 9536339
Alignment:
| Q |
18 |
ataaaacgccccagctgctttcatgcataacatattcttgaccccttcatgcattggcatgttcccttgcttaagttccagaaattcttgctctttctta |
117 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9536125 |
ataaaatgccccagctgctttcatgcataacatatccttgaccccttcatttattgacatgttcccttgcttaagttccagaaattcttgctctttctta |
9536224 |
T |
 |
| Q |
118 |
atcttgaaagactttggaaggtacttctccattattgctttcttaaaactagcccaattgatttctacatcattgaccgttatacgacgttgagcacctt |
217 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
9536225 |
atcttgaaagacttcggaaggtacttctccattattgctttcttaaaactagcccaattgatttctacatcattgaccgtcatacgacgttgagcacctt |
9536324 |
T |
 |
| Q |
218 |
cccaccaatcctatg |
232 |
Q |
| |
|
|||||||||| |||| |
|
|
| T |
9536325 |
cccaccaatcttatg |
9536339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University