View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14006_high_25 (Length: 217)
Name: NF14006_high_25
Description: NF14006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14006_high_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 108 - 209
Target Start/End: Original strand, 222732 - 222833
Alignment:
| Q |
108 |
acctggcaacatccgagaaaggggatttcgtggaattagaagagttcttcccccaggcaacgcctaaggttttctggttggtggtggtagttgttctctg |
207 |
Q |
| |
|
||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
222732 |
acctggcaacatcggagaaaggggattttgtggaattagaagagttcttcccccaggcgacgcctaaggttttctggttggtggtggtagttgttttctg |
222831 |
T |
 |
| Q |
208 |
ct |
209 |
Q |
| |
|
|| |
|
|
| T |
222832 |
ct |
222833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 222630 - 222705
Alignment:
| Q |
1 |
tgtagttttcgattcttctcagtcatgtaactgtaatagtgacatttttcaattaaatactgagaaattgagaagg |
76 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
222630 |
tgtagttttcgattcttctcagtcatgtaactgtaatagtgacatttttcaattaaatactgagaaattgagaagg |
222705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University