View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14006_low_10 (Length: 322)
Name: NF14006_low_10
Description: NF14006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14006_low_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 194 - 304
Target Start/End: Complemental strand, 142014 - 141904
Alignment:
| Q |
194 |
gagaactaataaagattaggttaaactttgaaggatgaaatatatctcaatcatataaaaataaatataaataacttgaaaactcataagggagagttac |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
142014 |
gagaactaataaagattaggttaaactttgaaggatgaaatatatctcaatcatataaaaataaatataaataacttgaaaactcacaagggagagttac |
141915 |
T |
|
| Q |
294 |
acggaacttac |
304 |
Q |
| |
|
||||||||||| |
|
|
| T |
141914 |
acggaacttac |
141904 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 104 - 159
Target Start/End: Complemental strand, 142105 - 142050
Alignment:
| Q |
104 |
tacattaaaataaattactagcaatatatattaccttctagcaagatttcacagtt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
142105 |
tacattaaaataaattactagcaatatatattaccttctagcaagatttcacagtt |
142050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University