View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14006_low_14 (Length: 286)
Name: NF14006_low_14
Description: NF14006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14006_low_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 16 - 216
Target Start/End: Complemental strand, 222650 - 222450
Alignment:
| Q |
16 |
tgagatgaatcgaaaactacacaatcagtttaacaccgaagaagcttccacttcttgtgtgaaccctatattcgccggagtttcaatttttgtcgatggt |
115 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
222650 |
tgagaagaatcgaaaactacacaatcagtttaacaccgaagaagcttccacttcttgtgggaaccctatattcgccggagtttcaatttttgtcgatggt |
222551 |
T |
 |
| Q |
116 |
ttcaccgttccttccagtcaggaactgcgtggatacatgttaaagtatggtggaagatttgagaattatttctcaaggcatcgtgtaacacatatcatct |
215 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
222550 |
ttcaccgttccatccagtcaggaactgcgtggatacatgttaaagtatggtggaagatttgagaattatttctcaaggcatcgtgtaacacatatcatct |
222451 |
T |
 |
| Q |
216 |
g |
216 |
Q |
| |
|
| |
|
|
| T |
222450 |
g |
222450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University