View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14006_low_15 (Length: 274)

Name: NF14006_low_15
Description: NF14006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14006_low_15
NF14006_low_15
[»] chr2 (1 HSPs)
chr2 (18-216)||(26540882-26541080)


Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 18 - 216
Target Start/End: Original strand, 26540882 - 26541080
Alignment:
18 agacaggaccacctttaccagcaggatcatggaccttctcttgcagcttatcaacttgaatgccaccttgatcttcctttgaaaacaaatcagttcttgt 117  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26540882 agacaggaccaccttttccagcaggatcatggaccttctcttgcagcttatcaacttgaatgccaccttgatcttcctttgaaaacaaatcagttcttgt 26540981  T
118 acgattttctcctccttctattgattcatatattgttgctgtctttgactcttttggttgtgctccttgtgccccagacatgttctttcactcttttat 216  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26540982 acgattttctcctccttctattgattcatatattgttgctgtctttgactcttttggttgtgctccttgtgccccagacatgttctttcactcttttat 26541080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University