View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14006_low_15 (Length: 274)
Name: NF14006_low_15
Description: NF14006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14006_low_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 18 - 216
Target Start/End: Original strand, 26540882 - 26541080
Alignment:
| Q |
18 |
agacaggaccacctttaccagcaggatcatggaccttctcttgcagcttatcaacttgaatgccaccttgatcttcctttgaaaacaaatcagttcttgt |
117 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26540882 |
agacaggaccaccttttccagcaggatcatggaccttctcttgcagcttatcaacttgaatgccaccttgatcttcctttgaaaacaaatcagttcttgt |
26540981 |
T |
 |
| Q |
118 |
acgattttctcctccttctattgattcatatattgttgctgtctttgactcttttggttgtgctccttgtgccccagacatgttctttcactcttttat |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26540982 |
acgattttctcctccttctattgattcatatattgttgctgtctttgactcttttggttgtgctccttgtgccccagacatgttctttcactcttttat |
26541080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University