View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14006_low_16 (Length: 267)
Name: NF14006_low_16
Description: NF14006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14006_low_16 |
 | |
|
| [»] scaffold0019 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 162; Significance: 2e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 9 - 227
Target Start/End: Original strand, 41317231 - 41317451
Alignment:
| Q |
9 |
gttaatgtgtagtcttctttatgaaagaaataggttgcaatgtgagggnnnnnnnnnctctcctttt--cctgcagcagtgacaattctttagaataaag |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
41317231 |
gttaatgtgtagtcttctttatgaaagaaataggttgcaatgtgagggtttttttttctctccttttttcctgcagcagtgacaattctttagaataaag |
41317330 |
T |
|
| Q |
107 |
ttatcttactgacatgtttcctgttttcaatattgctggannnnnnnatttattaggatttgatttggttgggaactttctatattttattagtttggtg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41317331 |
ttatcttactgacatgtttcctgttttcaatattgctggatttttttatttattaggatttgatttggttgggaactttctatattttattagtttggtg |
41317430 |
T |
|
| Q |
207 |
atcttactggtggtgagtgaa |
227 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
41317431 |
atcttactggtggtgagtgaa |
41317451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0019 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: scaffold0019
Description:
Target: scaffold0019; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 66 - 224
Target Start/End: Complemental strand, 120262 - 120107
Alignment:
| Q |
66 |
ctctccttttcctgcagcagtgacaattctttagaataaagttatcttactgacatgtttcctgttttcaatattgctggannnnnnnatttattaggat |
165 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
120262 |
ctctccttttcctgcagcagtgaaaattctttagaataaagttatcttactgacatgtttcctgttttcaatattgctg---atttttttttattaggat |
120166 |
T |
|
| Q |
166 |
ttgatttggttgggaactttctatattttattagtttggtgatcttactggtggtgagt |
224 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
120165 |
ttgatttggttgggaactttccatgttttattagtttggtgatcttactggtggtgagt |
120107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University