View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14006_low_19 (Length: 249)
Name: NF14006_low_19
Description: NF14006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14006_low_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 4 - 233
Target Start/End: Original strand, 31777095 - 31777324
Alignment:
| Q |
4 |
gcacattgtagtatttgtttggtttaacgtctaagaggaaattagctaaaaagagtgtcttctctccaaacgtgagtttactacgctgtaccaaagaaac |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
31777095 |
gcacattgtagtatttgtttggtttaacgtctaagaggaaattagctaaaaagagtatcttctcaccaaacgtgagtttactacgctgtaccaaagaaac |
31777194 |
T |
|
| Q |
104 |
aaacatatgtgtaatatactattgctttcttttcatattttaagttaaaaagagtggctttcactccaaacttctacaggttcccgcaagaacccaagga |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31777195 |
aaacatatgtgtaatatactattgctttcttttcatattttaagttaaaaagagtggctttccctccaaacttctacaggttcccgcaagaacccaagga |
31777294 |
T |
|
| Q |
204 |
atctaccggttcggcgacacgtgaagaagt |
233 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |
|
|
| T |
31777295 |
atctacaggttcggcgacacgtgaagaagt |
31777324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University