View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14006_low_27 (Length: 227)
Name: NF14006_low_27
Description: NF14006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14006_low_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 24 - 221
Target Start/End: Complemental strand, 32862612 - 32862414
Alignment:
| Q |
24 |
tttataagttactctgcaccaatcagcttagaatacttatatcttgagctagaaaactcgttttttagtagaactagtttagactgaaagaagaaatgta |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32862612 |
tttataagttactctgcaccaatcagcttagaatacttatatcttgagctagaaaactcgttttttagtagaactagtttagactgaaagaagaaatgta |
32862513 |
T |
 |
| Q |
124 |
gtag-ttccttcatattatatctcataattttatcatatacctacatgtagtagttccttcacatatcttctgtcacaaaaatttaaggtaaagttgct |
221 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
32862512 |
gtagtttccttcgtattatatctcataattttatcatatacctacatgtagtagttccttcacatatcttctatcacaaaaatttaaggtaaagttgct |
32862414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University