View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14006_low_8 (Length: 384)
Name: NF14006_low_8
Description: NF14006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14006_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 110; Significance: 2e-55; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 247 - 364
Target Start/End: Original strand, 15671927 - 15672044
Alignment:
| Q |
247 |
gtttcccttaagatcagtctctttgtttggtgtctacttcaccatcgtattcctacaatggataatttaatcataaagcaaattcttcagtctaacgtgc |
346 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15671927 |
gtttcccttaagatcagtttctttgtttggtgtctacttcaccatcgtattcctacaatggacaatttaatcataaagcaaattcttcagtctaacgtgc |
15672026 |
T |
|
| Q |
347 |
atctttatgtggacggtt |
364 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
15672027 |
atctttatgtggacggtt |
15672044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 119 - 173
Target Start/End: Original strand, 15671881 - 15671935
Alignment:
| Q |
119 |
gaatcttataatataatttttaataaaaaatatttattcagattttgtttacctt |
173 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
15671881 |
gaatcttataatagaatttttaataaaaaatatttattcagattttgtttccctt |
15671935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 12 - 52
Target Start/End: Original strand, 15671774 - 15671814
Alignment:
| Q |
12 |
atgaatgctatttattgttaatataattcattttggtttgt |
52 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15671774 |
atgaatgctatttattgttaatataattcattttggtttgt |
15671814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 24 - 52
Target Start/End: Original strand, 46798484 - 46798512
Alignment:
| Q |
24 |
tattgttaatataattcattttggtttgt |
52 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
46798484 |
tattgttaatataattcattttggtttgt |
46798512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University