View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14007_high_2 (Length: 540)
Name: NF14007_high_2
Description: NF14007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14007_high_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 376; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 376; E-Value: 0
Query Start/End: Original strand, 1 - 415
Target Start/End: Complemental strand, 46737889 - 46737478
Alignment:
| Q |
1 |
agaaaaaattaaacaatggctgatatgcttcgcgggaaatagcactacccttcgaaaaattaaacagtggctgacttggctagtagcaatggtgaatgga |
100 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46737889 |
agaaaaaattaaacagtg-ctgatatgcttcgcgggaaatagcactacccttcgaaaaattaaacagtggctgacttggctagtagcaatggtgaatgga |
46737791 |
T |
 |
| Q |
101 |
atgttattattttggaaaaatgcatgctagagatataatttggagaattatggctttaacttctccgaatggtaagtgcttgcgacctggtggaatatcc |
200 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46737790 |
atgttattattttggaaaaatgcatactagagatataatttggagaattatggcttcaacttctccgaatggtaagtgcttgcgacctggtggaatatcc |
46737691 |
T |
 |
| Q |
201 |
ggtttcctcctcatataatttgttgtgcaattttcatgatgagaatacactgatataggatggaatcggatttggaggtttggaaaatagtagatcccta |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
46737690 |
ggtttcctcctcatataatttgttgtgcaattttcatgatgagaat--actgatataggatggaatcggatttggaggtttggaaaataggagatcccta |
46737593 |
T |
 |
| Q |
301 |
ttgcatgcagtgtggccaattaatagagactacgttacatgtgatgagggactgcccactagctttggttgtttggttgaatgtggtaaagattgaatat |
400 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46737592 |
ttgcatgcattgtggccaattaatagagactacgttacatgtgatgagggactgcccactagctttggttgtttggttgaatgtggtaaagattgaatat |
46737493 |
T |
 |
| Q |
401 |
cggctacaatttttc |
415 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
46737492 |
cggctacaatttttc |
46737478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University