View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14007_high_9 (Length: 264)
Name: NF14007_high_9
Description: NF14007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14007_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 3e-94; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 1 - 179
Target Start/End: Complemental strand, 5828411 - 5828233
Alignment:
| Q |
1 |
ttggttgagaaagacatggttctatgtaaaaagtatagttttggcaaatatgatgagatattatttagcaaagaaggaacaatagattatttctctttct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5828411 |
ttggttgagaaagacatggttctatgtaaaaagtatagttttggcaaatatgatgagatattatttagcaaagaaggaacaatagattatttctctttct |
5828312 |
T |
 |
| Q |
101 |
ttgtttttgtgtttatttgtaatgagaagtgttgaagatggatatgatttggaaatgaaaaacatatgggtatatataa |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5828311 |
ttgtttttgtgtttatttgtaatgggaagtgttgaagatggatatgatttggaaatgaaaaacatatgggtatatataa |
5828233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 220 - 264
Target Start/End: Complemental strand, 5828192 - 5828148
Alignment:
| Q |
220 |
gctaatagtgggtatattatattatatgttgaaatggaagtggta |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5828192 |
gctaatagtgggtatattatattatatgttgaaatggaagtggta |
5828148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University