View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14007_low_15 (Length: 238)
Name: NF14007_low_15
Description: NF14007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14007_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 10 - 221
Target Start/End: Complemental strand, 28543619 - 28543409
Alignment:
| Q |
10 |
aaaagaaggttcatttgagagtttgagtctcttgaacgagtgtggtaagtaccaactgcagacttggacttggggttttgagaaatatttcgtctttagg |
109 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28543619 |
aaaagaaggttcatt-gagagtttgagtctcttgaacgagtgtggtaagtaccaactgcagacttggacttggggttttgagaaatatttcgtctttagg |
28543521 |
T |
 |
| Q |
110 |
agcaccccccaaaactcaccagttggttgcaattccatttgaaccttaggattgagctctttgtagttaacaactcatcctgagattaagtagaattgat |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
28543520 |
agcaccccccaaaactcaccagttggttgcaattccatttgaaccttaggattgagctctttgtagttaacaattcatcctgagattaagtagaattgat |
28543421 |
T |
 |
| Q |
210 |
caccacaatttt |
221 |
Q |
| |
|
|||||||||||| |
|
|
| T |
28543420 |
caccacaatttt |
28543409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University