View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14007_low_17 (Length: 223)
Name: NF14007_low_17
Description: NF14007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14007_low_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 24 - 203
Target Start/End: Original strand, 7309594 - 7309773
Alignment:
| Q |
24 |
gaattatattcatcaatctcaatcgcacgtctgtttcgagaagcatttcttattctttcatgatcatgatcatcatcagaaccagattcaggatcatcaa |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
7309594 |
gaattatattcatcaatctcaatcgcacgtctatttcgagaagcatttcttattctttcatgatcatgatcatcatcagaaccagatccaaaatcatcaa |
7309693 |
T |
|
| Q |
124 |
tcctatgtctatttcgataagaataatcagacgaagtttgtgtgctcattatttcatgatcattttcagaatcatcattt |
203 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7309694 |
tcctatgcctatttcgataagaataatcagacgaagtttgtgtgctcattatttcatgatcattttcagaatcatcattt |
7309773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University