View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14007_low_18 (Length: 218)
Name: NF14007_low_18
Description: NF14007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14007_low_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 13 - 202
Target Start/End: Complemental strand, 32988998 - 32988809
Alignment:
| Q |
13 |
ttatactattgcaactagaggaaaatcatttttgtttgttcccaaagattaagggtgtgtttggttctaacaagttagtatattctaacttttagtcaaa |
112 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32988998 |
ttatactattgcaacgagaggaaaatcatttttgtttgttcccaaagattaagggtgtgtttggttctaacaagttagtatattctaacttttagtcaaa |
32988899 |
T |
 |
| Q |
113 |
atcagttcttgtctaaagtctaaactcaattttattaagtttcataatcacttttgactccccaaaatttaaatctaaagatgcactaat |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32988898 |
atcagttcttgtctaaagtctaaactcaattttattaagttttataatcacttttgactccccaaaatttaaatctaaagatgcactaat |
32988809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University