View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14008_high_6 (Length: 339)
Name: NF14008_high_6
Description: NF14008
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14008_high_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 39 - 321
Target Start/End: Complemental strand, 6314127 - 6313845
Alignment:
| Q |
39 |
agattatactgctgcaatgaagaaaatgtgctgtctagtgttggaattaatggctgatgggttggggattgagccaaagaatgtgttaagcaggttattg |
138 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6314127 |
agattatattgctgcaatgaagaaaatgtgctgtctagtgttggaattaatggctgatgggttggggattgagccaaagaatgtgttaagcaggttattg |
6314028 |
T |
|
| Q |
139 |
aaagatgagaaaagtgattcttgtttcagaattaaccattacccaccgtgccctgaggtgcaacaagcagcattaaatggaaggaatttgcttgggtttg |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6314027 |
aaagatgagaaaagtgattcttgtttcagaattaaccattacccaccgtgccctgaggtgcaacaagcagcattgaatggaaggaatttgcttgggtttg |
6313928 |
T |
|
| Q |
239 |
gggagcatacagacccacaagtcatttctgtcttgagatctaatagcacatcaggactgcaaatctgtctcactgatggaact |
321 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6313927 |
gggagcatacagacccacaagtcatttctgtcttgagatctaatagcacatcaggactgcaaatctgtctcactgatggaact |
6313845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 79 - 164
Target Start/End: Original strand, 38545217 - 38545302
Alignment:
| Q |
79 |
ttggaattaatggctgatgggttggggattgagccaaagaatgtgttaagcaggttattgaaagatgagaaaagtgattcttgttt |
164 |
Q |
| |
|
|||||||||||||| ||||| ||| ||||||| |||| ||||||||| ||||| || ||| |||||||| ||||||||||||||| |
|
|
| T |
38545217 |
ttggaattaatggcagatggattgaggattgaaccaaggaatgtgtttagcagattggtgagagatgagagaagtgattcttgttt |
38545302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 310
Target Start/End: Original strand, 38545355 - 38545442
Alignment:
| Q |
223 |
aatttgcttgggtttggggagcatacagacccacaagtcatttctgtcttgagatctaatagcacatcaggactgcaaatctgtctca |
310 |
Q |
| |
|
|||||| |||| |||||||||||||| |||||||| | || |||||| | || ||||||| |||||||||||||||| ||||||| |
|
|
| T |
38545355 |
aatttgattggatttggggagcatactgacccacagataatatctgtcctaaggtctaataatgcatcaggactgcaaatttgtctca |
38545442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University