View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14008_high_9 (Length: 229)
Name: NF14008_high_9
Description: NF14008
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14008_high_9 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 118; Significance: 2e-60; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 20 - 157
Target Start/End: Complemental strand, 3019654 - 3019518
Alignment:
| Q |
20 |
attgcggtgttttttctagttataatatcaatgatcacatggtctgtttagcttggacccatgagatgacctagcattggaggtatcaaccaacttttca |
119 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
3019654 |
attgcggtgttttt-ctagttataatatcaatgatcacatggtctatttagcttggacccatgagatgccctagcattggaggtatcaaccgacttttca |
3019556 |
T |
 |
| Q |
120 |
ttaagtttttaaagaaaatggtgtaggggaataacatc |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3019555 |
ttaagtttttaaagaaaatggtgtaggggaataacatc |
3019518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 30 - 111
Target Start/End: Complemental strand, 3021274 - 3021193
Alignment:
| Q |
30 |
tttttctagttataatatcaatgatcacatggtctgtttagcttggacccatgagatgacctagcattggaggtatcaacca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| ||||||||||||| ||| | |||||||| ||| |||||||||||||| |
|
|
| T |
3021274 |
tttttctagttataatatcaatgatcacatcgtccgtttagcttggactcataaaatgacctaccataggaggtatcaacca |
3021193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University