View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14008_low_7 (Length: 234)
Name: NF14008_low_7
Description: NF14008
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14008_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 19 - 222
Target Start/End: Complemental strand, 1393605 - 1393401
Alignment:
| Q |
19 |
attgttctataattgagttgcacagctagtactgaaactagctatttatataatgttttgaaattggtttctgattaattataccaatggttttggattg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1393605 |
attgttctataattgagttgcacagctagtactgaaactagctatttatataatgttttgaaattggtttctgattaattataccaatggttttggattg |
1393506 |
T |
 |
| Q |
119 |
tgaaaatgataaacattccatattaaccacatgagattgg-nnnnnnnttgtatactggccttatcataatgcaccactatgtgaatgccacgtggatga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
1393505 |
tgaaaatgataaacattccatattaaccacatgagattggaaaaaaaattgtatactggccttatcataatgcaccactatgtgaatgccacatggatga |
1393406 |
T |
 |
| Q |
218 |
tgtcc |
222 |
Q |
| |
|
||||| |
|
|
| T |
1393405 |
tgtcc |
1393401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University