View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14009_low_17 (Length: 248)
Name: NF14009_low_17
Description: NF14009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14009_low_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-119; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 47909288 - 47909054
Alignment:
| Q |
1 |
attgttgctgccatcatgtcttttggttatgcttccataggcattggtctctccatagcgaaaattgcaggttagacactaattgctaatagcgaaatat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
47909288 |
attgttgctgccatcatgtcttttggttatgcttccataggcattggtctctccatagcgaaaattgcaggttagacactaattgctaatagtgaaatat |
47909189 |
T |
|
| Q |
101 |
aaacatatatggttgtgtcgcgaacatatgtagtaatgttgtgtcgcgaacaaatatggttgatgaccaaggtgtttatttaagtatttttcacgagagg |
200 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
47909188 |
aaacatatatggctgtgtcgcgaacaaatgtagtaatgttgtgtcgcgaacaaatatggttgatgaccaa-gtgtttatttaagtatttttcacgagagg |
47909090 |
T |
|
| Q |
201 |
tgaatacgatatataaatgatacttattacaatatt |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
47909089 |
tgaatacgatatataaatgatacttattacaatatt |
47909054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 78
Target Start/End: Complemental strand, 47917489 - 47917412
Alignment:
| Q |
1 |
attgttgctgccatcatgtcttttggttatgcttccataggcattggtctctccatagcgaaaattgcaggttagaca |
78 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
47917489 |
attgttgctgccatcatgtcttttggttatgcttccataggcattggtctctccatagccaaaattgcaggttagaca |
47917412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 55
Target Start/End: Complemental strand, 47898120 - 47898066
Alignment:
| Q |
1 |
attgttgctgccatcatgtcttttggttatgcttccataggcattggtctctcca |
55 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
47898120 |
attgttgctgccatcatgtcttttggttatgcttccataggcattggcctctcca |
47898066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 5 - 75
Target Start/End: Complemental strand, 47902605 - 47902535
Alignment:
| Q |
5 |
ttgctgccatcatgtcttttggttatgcttccataggcattggtctctccatagcgaaaattgcaggttag |
75 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| |||||||| || || ||| ||||||||||| |
|
|
| T |
47902605 |
ttgctgccgtcatgtcttttggttatgcttccataggcatcggtctctctattgcaaaagttgcaggttag |
47902535 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 5 - 75
Target Start/End: Complemental strand, 47923743 - 47923673
Alignment:
| Q |
5 |
ttgctgccatcatgtcttttggttatgcttccataggcattggtctctccatagcgaaaattgcaggttag |
75 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
47923743 |
ttgctgcagtcatgtcttttggttattcttccataggtgttggtctctccatagccaaaattgcaggttag |
47923673 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University