View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1400_high_3 (Length: 331)
Name: NF1400_high_3
Description: NF1400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1400_high_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 116; Significance: 5e-59; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 153 - 321
Target Start/End: Complemental strand, 5172286 - 5172118
Alignment:
| Q |
153 |
agaatgtaacattgttaaatatttttagagataagtttgtcatctattgtaatattatccgacttnnnnnnnttaatctattcctttatgcacaaatgat |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| ||||||| |||||||||||||||| ||||||||| | ||||||||||||| || |
|
|
| T |
5172286 |
agaatgtaacattgttaaatatttttagagataattttgttatctattataatattatccgacttaaaaaaattaatctatacatttatgcacaaatcat |
5172187 |
T |
|
| Q |
253 |
acacaattacaaataatggaactattctagcacaagtaactcatagaatagctcacaacaaggttcatc |
321 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
5172186 |
acaaaattacaaataatggaactattctagcacaagtaactcatagaataactcacaacaaggttcatc |
5172118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University