View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14010_high_17 (Length: 226)
Name: NF14010_high_17
Description: NF14010
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14010_high_17 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 18 - 118
Target Start/End: Complemental strand, 35853159 - 35853063
Alignment:
| Q |
18 |
attatgaatgtaatttaagattattatgaatgtaaacagtagtgtaactattgaaaactatttattttctcacctttcccatcctcttgtgcgctcttaa |
117 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35853159 |
attatgaatgtaatttaagattat---gaatgtaaacagtagtgtaactattgaagactatttattttctcaccttt-ccatcctcttgtgcgctcttaa |
35853064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 163 - 210
Target Start/End: Complemental strand, 35853025 - 35852978
Alignment:
| Q |
163 |
agggaaattcgatttagattatataactcgaatgataaagatatactt |
210 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35853025 |
agggaaatccgatttagattatataactcgaatgataaagatatactt |
35852978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University