View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14010_low_14 (Length: 285)
Name: NF14010_low_14
Description: NF14010
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14010_low_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 269
Target Start/End: Original strand, 4189580 - 4189859
Alignment:
| Q |
1 |
atacttggactcatgttcatgcttgggctcatgctcgggc------------tttctggtggcaatgattcaggggaggaggcaggtgaaggagtgtgca |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4189580 |
atacttggactcatgttcatgcttgggctcatgctcgggctctggcttgggctttctggtggcaatgattcaggggaggaggcaggtgaaggagtgtgca |
4189679 |
T |
 |
| Q |
89 |
gcatgatgggtccaggggagggtgcttgggctatggacattactaccagagaaagggacatggctagcatgagcgtggcacgtgtgaatgccattgttac |
188 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4189680 |
gcatgatgggtccaggagagggtgcttgggctatggacattactaccagagaaagggacatggctagcatgagcgtggcacgtgtgaatgccattgttac |
4189779 |
T |
 |
| Q |
189 |
acgagggagaacaaagagaaacagaaacagaacagagcaatggaagttttgttctgtgatggatatatagatagtagaaaa |
269 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4189780 |
acgagggagaagaaagagaaacag-aacagaacagagcaatggaagttttgttctgtgatggatatatagatagtagaaaa |
4189859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University