View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14010_low_18 (Length: 226)

Name: NF14010_low_18
Description: NF14010
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14010_low_18
NF14010_low_18
[»] chr8 (2 HSPs)
chr8 (18-118)||(35853063-35853159)
chr8 (163-210)||(35852978-35853025)


Alignment Details
Target: chr8 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 18 - 118
Target Start/End: Complemental strand, 35853159 - 35853063
Alignment:
18 attatgaatgtaatttaagattattatgaatgtaaacagtagtgtaactattgaaaactatttattttctcacctttcccatcctcttgtgcgctcttaa 117  Q
    ||||||||||||||||||||||||   |||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||    
35853159 attatgaatgtaatttaagattat---gaatgtaaacagtagtgtaactattgaagactatttattttctcaccttt-ccatcctcttgtgcgctcttaa 35853064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 163 - 210
Target Start/End: Complemental strand, 35853025 - 35852978
Alignment:
163 agggaaattcgatttagattatataactcgaatgataaagatatactt 210  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||    
35853025 agggaaatccgatttagattatataactcgaatgataaagatatactt 35852978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University