View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14010_low_19 (Length: 213)
Name: NF14010_low_19
Description: NF14010
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14010_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 97; Significance: 7e-48; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 22 - 134
Target Start/End: Complemental strand, 6086801 - 6086690
Alignment:
| Q |
22 |
agtcataaataatcttgtggtacatatttaattggtggatgttttattctctattgtgatattagatatttatatgtactatttccaatatgcaataatc |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6086801 |
agtcataaataatcttgtggtacatatttaattggtggatgttttattctc-attgtgatattagatatttatatgtgctatttccaatatgcaataatc |
6086703 |
T |
 |
| Q |
122 |
ttgataaaatgta |
134 |
Q |
| |
|
|||||||||||| |
|
|
| T |
6086702 |
gtgataaaatgta |
6086690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 132 - 197
Target Start/End: Complemental strand, 6086627 - 6086563
Alignment:
| Q |
132 |
gtaattaaattttaacttttatatattgattttaatgggaaaaaatgtgtatattattaataaact |
197 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6086627 |
gtaattaaattttaacttt-atatattgattttaatgggaaaaaatgtgtatattattaataaact |
6086563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 54 - 86
Target Start/End: Complemental strand, 4511144 - 4511112
Alignment:
| Q |
54 |
tggtggatgttttattctctattgtgatattag |
86 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
4511144 |
tggttgatgttttattctctattgtgatattag |
4511112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University