View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14011_low_2 (Length: 245)
Name: NF14011_low_2
Description: NF14011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14011_low_2 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 1854856 - 1855100
Alignment:
| Q |
1 |
agagagatgaatatatggtcaggtcttccatgcaacttgcaagtcaatgcaacttttatttaaattagcaaaataccatgaaaatttggaagggttttta |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1854856 |
agagagaagaatatatggtcaggtcttccatgcaacttgcaagtcaatgcaacttttatttaaattagcaaaataccatgaaaatttggaagggttttta |
1854955 |
T |
 |
| Q |
101 |
ttataaataacgaaacacccttactctaggccacaagtcagtcagtactccaatttaaaaatgaaggtcctgcaagtattaataatacttgctgcattag |
200 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1854956 |
ttataaataacgaaacacccttactccaggccacaagtcagtcagtactccaatttaaaaatgaaggtcctgcaagtattaataatacttgctgcattag |
1855055 |
T |
 |
| Q |
201 |
cacatttgatagaagcagttgcatttacacttgcatctgatcaac |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1855056 |
cacatttgatagaagcagttgcatttacacttgcatctgatcaac |
1855100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University