View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14011_low_5 (Length: 209)
Name: NF14011_low_5
Description: NF14011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14011_low_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 60; Significance: 9e-26; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 16 - 83
Target Start/End: Original strand, 51982045 - 51982112
Alignment:
| Q |
16 |
agatgatatgggttggaaataaaagaaaattataaatagattgaagaagtgggtgtttagaattctat |
83 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
51982045 |
agatgatatgggttggaaataaaaaaaaattataaatagattgaagaagtgggtgtttagaatcctat |
51982112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University