View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14011_low_5 (Length: 209)

Name: NF14011_low_5
Description: NF14011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14011_low_5
NF14011_low_5
[»] chr3 (1 HSPs)
chr3 (16-83)||(51982045-51982112)


Alignment Details
Target: chr3 (Bit Score: 60; Significance: 9e-26; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 16 - 83
Target Start/End: Original strand, 51982045 - 51982112
Alignment:
16 agatgatatgggttggaaataaaagaaaattataaatagattgaagaagtgggtgtttagaattctat 83  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||    
51982045 agatgatatgggttggaaataaaaaaaaattataaatagattgaagaagtgggtgtttagaatcctat 51982112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University