View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14012_low_5 (Length: 239)
Name: NF14012_low_5
Description: NF14012
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14012_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 3 - 222
Target Start/End: Complemental strand, 15263007 - 15262788
Alignment:
| Q |
3 |
tgcgtgtggttgtaattacctgcagcggccgtgacagattcacctgtcatgccggttatgagtccatgaccggcagtagctgccgctgcgatactcaagt |
102 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15263007 |
tgcgtgtggtggtaattacctgcagcggccgtgacagactcacctgtcatgccggttatgagtccatgaccggcagtagctgccgctgcgatactcaagt |
15262908 |
T |
 |
| Q |
103 |
tttgaaaacgagaaagttcggatttagcacaataaagatccatctgaagttgacgaagttggtgttgaaggagagaaattacaccaacacaaccataaac |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15262907 |
tttgaaaacgagaaagttcggatttagcacaataaagatccatctgaagctgacgaagttggtgttgaaggagagaaattacaccaacacaaccataaac |
15262808 |
T |
 |
| Q |
203 |
aggatctcgaagtcgcatct |
222 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
15262807 |
aggatctcgaagtcgcatct |
15262788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University