View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14013_low_6 (Length: 242)
Name: NF14013_low_6
Description: NF14013
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14013_low_6 |
 | |
|
| [»] scaffold1297 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 17 - 235
Target Start/End: Original strand, 8316714 - 8316932
Alignment:
| Q |
17 |
aaatagaatcaggtaaaaaggagcagcagtttgtaaattttgttggcagagcacttctccttacttcaatctcaagcatggagttggaaagattttcttt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8316714 |
aaatagaatcaggtaaaaaggagcagcagtttgtaaattttgttggcagagcacttctccttacttcaatctcaagcatggagttggaaagattttcttt |
8316813 |
T |
|
| Q |
117 |
actgatcaataacaagcgtgatatatcccttcaaaatacttggatctctagcatcttgaatcggagagtaaaaattcttcggatccattcatctttttat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8316814 |
actgatcaataacaagcgtgatatatcccttcaaaatacttggatctctagcatcttgaatcggagagtaaaaattcttcggatccattcatctttttat |
8316913 |
T |
|
| Q |
217 |
cagctcctcttctctgctc |
235 |
Q |
| |
|
||||||| ||| ||||||| |
|
|
| T |
8316914 |
cagctccccttttctgctc |
8316932 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1297 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold1297
Description:
Target: scaffold1297; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 140 - 216
Target Start/End: Complemental strand, 2125 - 2046
Alignment:
| Q |
140 |
tatcccttcaaaatacttggatctctagcatcttg---aatcggagagtaaaaattcttcggatccattcatctttttat |
216 |
Q |
| |
|
|||| ||||||||||| |||||||||| ||||||| ||| ||||||| || | |||| |||||||||||| ||||||| |
|
|
| T |
2125 |
tatcacttcaaaatacatggatctctaccatcttgaataataggagagtcaagaatcttaggatccattcatatttttat |
2046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 100 - 173
Target Start/End: Complemental strand, 28111777 - 28111704
Alignment:
| Q |
100 |
ttggaaagattttctttactgatcaataacaagcgtgatatatcccttcaaaatacttggatctctagcatctt |
173 |
Q |
| |
|
||||||| |||||||| ||||| ||||||| ||| | |||| ||||||||||| ||||||||||||||||| |
|
|
| T |
28111777 |
ttggaaaacttttcttttgtgatctataacaaacgttgtgtatcacttcaaaatacatggatctctagcatctt |
28111704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University