View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14014_high_23 (Length: 235)
Name: NF14014_high_23
Description: NF14014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14014_high_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 1 - 194
Target Start/End: Complemental strand, 21643800 - 21643607
Alignment:
| Q |
1 |
gctagtctgtgttcactatcaccccatgtttctttgtcttttggatctactggtagaacaaatgaacctgcatttctatacttttgaagctgatagctgc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
21643800 |
gctagtctgtgttcactatcaccccatgtttctttgtcttttggatctactggtagaacaaatgagcctgcatttctatacttttgaagctgatagctgc |
21643701 |
T |
 |
| Q |
101 |
aaacaatatcaaaagatttttcagtaaatccgattaaatgtgtgtctgatgtccgaaaaatgttagcgttcaaccctagggcacaaacacatgt |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| ||| |||||||| ||||||| || | ||||| |||||||||| |||| ||||||||| |
|
|
| T |
21643700 |
aaacaatatcaaaagatttttcagtaaatctgattgaatatgtgtctggtgtccgacaagttttagcattcaaccctaatgcaccaacacatgt |
21643607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University